Pages

Monday, December 31, 2007

jes@lastDayOf2007 ScriPt 9

Yoyo, so long seem my last post..
Last day of 2007..
And this is my last post of 2007.
Suddenly felt so lonely. lol
Lucky got Eng Suo who drink Vodka(Pear), eat chocolate, eat peanut, watch TV with me..hahha.
It is a bad year 2007.
it is also a not bad year 2007, at least the first half of the year is a good year.
2008 is coming in a few hours time. There is only now and MY future.
New year, New Year. awaiting for the new Year.
And i have a big plan in year 2008. Hope the plan will come true.. Hope HOPE hope...
It is a special year for me...
because
"A Key of freedom" is waiting for me... ... ...
See You Next Year.
Good nite.. zzzzZZZ

Thursday, December 20, 2007

jes@spentThe$$Day ScriPt 8

Wahahahahhah..
So happy today.

I get what i want, i get everything I want.

Today is THE SPENT all MY MONEY DAY.
went to buy 2 pants at Jp just now. cost $50~
then went to meet Prem and brought WHAT we want @ raffles city!


what we want!

this is mine .. and it cost a bomb!

This is what we eat.. Thai Express....
This is what we drink!.. starBucks..
"Santa Claus drop the money for me to spent".. LOL
"we are not Rich ass..."
really enjoy my day today.

jes@sianDiao ScriPt 7

just came back FRom AMK Hub(i hate AMK) LOL
just eaten 2 donuts from donut factory my supper!

Went to meet Jo and sc and prem also at AMK!.
hmmm... strange strange feeling...

Let the past be the past. It is over. There is nothing you can do about it. It doesn’t matter what you do now you cannot change the past. The past has got you to where you are today now, move on.
There is only now and MY future.
So, instead of focussing on the past, focus on doing your best; now.
If you feel really fed up. If you feel as though the world is against you. If you feel as if you should have done better.
There is only one thing you can do.
SMILE.
"Here, on this earth because the world needs you as you are! You are important to the world, just as you are. You have an important role to play. Just look at yourself. You can only be yourself... there is no possibility that you can be anybody else. You are unique. you are full of possibilities"

so just enjoy your lifevand bloom,
don't wither away like a dead flower.
Go on…… accept it!

let's start a NEW year! looking forward to year 2009.
opppss,
is 1.40am now..
but no worry..
cos tomorrow is public holiday! HAPPY publiC Holiday!

Monday, December 17, 2007

jes@office ScriPt 6

Lunch hr time..
I was waiting for Mr. Prem to have lunch with me...
Hungry Hungry!..
Mr Prem finally Called me... Lunch 1st.

Thursday, December 13, 2007

jes@1stTear ScriPt 5

DO u remember this:




DNA -> Transcription -> RNA -> Translation -> PROTEIN
GATCTAGTGCTAGTCGATCGTAGCTAGCTAGCTAGTTTTCGATCG
5' → 3' , 3' → 5'
Needleman-wunsch
BLAST
DOT PLOT
and ALOT ALOT BIO THIS AND BIO THAT
LOL

so When is my FIRST tear in school(PRI, SEC,POLY)?
when i feel so stress with that MASCOT FILTERING TOOL, that WTH C#.net, and that WTF F**ker, feel so lonely inside the BIOMEDICAL ENGINEERING HUB, so shag....
THE BEST Thing!
Being PS by 2 friends for lunch, when i only have them to have lunch with, when i have told them I WAS ALONE and ASK them to PEI me EAT a few hours back only! within that 10seconds, being ps by them. This is when I dropped my 1st TEAR in school, NYP. During my most SHAG time, most STRESS time, and MOST SAD TIME. I gonna PS WITHIN that 10s. I WILL NV FORGET!

Ya, People become stronger because they have thing they cannot forget!

and therefore

I BECOME STRONGER!



Saturday, December 8, 2007

jes@omg ScriPt 4

what's Happening today?
My 1st report at BoonLay NPP! but is not regarding myself zzz.. Just helping to translate..

Went to my Grandpa house today. Saw my grandpa, he is getting older each time i visit him. HAVE YOU EVER ASK YOURSELF, WHEN IS THE LAST VISIT YOU VISIT YOUR GRANDPARENT?

The happening is below
======================================
Eng suo: shan, let's go le.
Jeszzho: go where?
Eng suo: Boon lay..
Jeszzho: go there for what?
Eng suo: uncle wanna to get police report for divorce thingy.. we go tag along.
......at Bonnlay NPP.....
when we reach there.. what i saw? A MALAY POLICE OFFICER! oh gosh.....
======================================

That's how i become a temp translator..

Friday, December 7, 2007

jes@happy ScriPt 3

Yoz,

someone say my blog very de EMO..
OK, today not going to be emo..

I going to teach you how to play with Rubik's cube. which i have just learnt also..
VERY SImPLE, pRovided that you aRe as clEver as me la....
noted that Rubik's Cube is to be solved LAyer by layEr!! very impt.



This is my cube... Play till lan oready.



Step 1: have to make the cross 1st. any color cross. In this case i chosen white.



Step 2: Solve the 4 white corner. The first layer got to solve by yourself... very simple de... goT to understand! U can see.. the 1st layer of orange and the green is in place also... pls go figure out Y they must be in place like that -_- '".



Step 3: 2nd layer... have algorithms to solve the 2nd layer. u can prefer to: http://www.youtube.com/watch?v=HsQIoPyfQzM / http://www.youtube.com/watch?v=IW_BBp3FPMQ&feature=relatedmust understand also. LOL i cheated..



Step 4 : the last layer! A cross 1st also.. refer to : http://www.youtube.com/watch?v=IW_BBp3FPMQ&feature=related / http://www.youtube.com/watch?v=HsQIoPyfQzM also..


COMPLETED!

Very simple right?

Saturday, December 1, 2007

jes@eMo ScriPt 2

Just came back from somewhere... Still felt very SHAG

but when i reach home...:
=================================================
Eng Suo: Got give her the $$ or not?
Jeszzho: WHAT MONEY? WHAT MONEY?
Jasbaobei: Got $300 lor..
Jeszzho: WHAT $300?
Jasbaobei: xxX give us $50 lar..

My heart: WAW.. the god so good, know i no $$ leh, drop $$ for me to spend $_$. hehee
My Heart: wa lao.. why the one who tio 4D not me......
=================================================

well..
This let me felt that this sentence is MOST right.
The rich become richer and the poor is still the poor..

see ar,
The rich, they have more money to buy 4D. They can bet a alots of 4D with a lots of $$. They can bet as big as they want, and then when they win, they win alots, alots and alots. And they in the end become RICHER.

The poor, who will not buy so big and so much as they are the poor, and then when they win, they are still the POOR.

ok. Still felt very shag today. Because.. it seens that things is getting bad to worst.

Friday, November 30, 2007

jes@eMo ScriPt 1

The 1st script to be shag, sad, helpless, and broken heart and Lost.

HAve thousand of words to write, so help me to counts whether have thousand of words or not provided that you have that times.
Just now went JP(THE JP SHIOK, I know AMK, J8, Coastway Point, Westmall IMM too. Dun be a noob) with Mr., ate big feast, drank high class coffee and then we walked from BoonLay MRT to Lakeside MRT station which took about 1/2hr(We so FREE). On the way, we chat a lot, heard a lot of secert from him..zzz.(I TOLD U I DUN WANT TO KNOW, MR PREM. DUN TELL ME, DUN TELL ME and DUN TELL ME next time) and i feel so Shag, so sad, so blank


and so and and .
A lot of things had changed(This and That, almost every single things). A lot of pple had changed(Including myself, you, you and you). We started to quarrel, argue, angry over small small little little thingy. Relationship started to change(And is so fast!), getting more and more confusing. I felt so helpless. So hopeless. Am I going to lost a lot of BFF?
I don't wish to be alone... I don't want o travel alone for the 45mins long journey, I want to chat with someone on the way too. Not to sit there lonelily, waiting for all the F**K#& latecomers(I AM SCOLDING ALL, INcluDing myself). Not i don't want. Do You KnOw WHat's the feeling of waiting? Waste Time, Waste time and is Waste time. And Now I forced myself to learn How to Be LATE laTe and latEr. What THE F! What THE H!
It's Time To call mr. prem. opsss
Oppsss, must specially thanks Mr. Prem for borrowing me his acer laptop. and helped me with my CPU, and wireless. Thank you, Mr. Prem.