jes@A BAD DAY! ScriPt 21

Today.. is a very BAD day. I MUSt BLOG it DOWN to remember this DAY! How bad is zit!? See below!

=====Early in the morning, I went to SIM for lesson. =====

BAD 1:
I DROPPED MY LAPTOP!. which causes a great impact! (Prompt some error with my Laptop after the DROP.)

BAD 2:
I FALL DOWN, with both my Knees HUrt. BAdly Hurt.. So painful! :(

====After some discuession on the ICT205 TMA I went home.... someone from SIM called me, "Hi, this is calling from SIM SECURITY....."=====

BAD 3:
I WENT HOME WITHOUT MY WALLET!

*luckily got prem, who drove me down to SIM to collect it again!

BAD 4:
I AM FALLING SICK AGAIN! sore throat + flu for now.
think tmr will get worse! maybe + fever!

well, see how bad was the day! and today is 11 october 2008! i should remember this day.....
Forever!??

However BAD, I must NEVER say die to the BAD!

jes@Happy wedding!!! ScriPt 20

Just have a bit of some time(I Haven complete my TMA02 for effective commm yet, i have some time to blog still dot dot dot)
Just came back from someone wedding... @ Raffles Town club.. a grand one and a better one.. (compare to my cousin one 2 weeks ago during MOONCAKE festive).

Hmmm... girls always look most beautiful in their wedding gowns.....

Opppss.. need to thank Mr. prem who came down from his house and drove me home so fast.....!
OK.. is 1am+ in the Morning.. thats means i have about 4.5 hours more to sleep....
TMR I HAVE TO GO BACK IRAS.!

Happy wedding, Happy honeymoon, Happy making babies.
Make the PM happy by making more babies! then it will not somehow lead to graying population(MY TMA topic.Zzzz) "then they will not have this topic in future for next generation to write!".

Congrate to the new couples, wishing all of you all the happiness of the world!

jes@on Sick leave!! ScriPt 19

.... ... fever + flu + sore throat ... ...
so terrible,
so weak...
have being MC for 2 days
finally have some energy and strength to on the laptop... and type something.... just something... and is really something... ..

jes@Long time no see ScriPt 18

Wow, long time no see!

finally new Skin which i make myself. Wahahasee...

determination..! I have so much time to do all this craps in 1 days!! photoshop my new skin... edit here and there..

and I have no time to do my uniSIM assignment?

COR100-TMA02 which is going to DEADLINE next monday i only start a little little something

ICT205-TMA01,

BUS101-TMA01GBA

That's is CRAZY! and I and going to be crazy.

actually is not no time, i know that. Its the matter of whether i want to do or not! I am Lazy, is an excuse.

Well hhaa.. I am clever! that's what most of them tell me! No need to study can get not bad grade! My sisters who always see me playing with the PC more then studying said that too! they always ask how how i still can get such a grade ar? NOT BAD ONE!! Everyday playing with the PC also can score!.

Well.. I am the study smart kind! How study smart.. Very simply! TWO big points!

Point 1. listen to the lecturer. you no to need to take down any notes actually! this is because when u take notes, you tend not to listen. Are you trying to copy everything what the lecturer say? you dun have the time! I am sure that you write slower and at the end you will actually miss a lot! so, what you have to do is to listen and understand what the lecturer said instead!

That's why till now i dun get use of taking down any notes! I think i will never get use of it - Note taking.

Point 2. when you study, dun try to memorize anything! no use! you will forget after your exam anyway. understand what you study is the most important thing! study smart.

practice make perfect. yes, is true. but i think that practice + understanding make more perfect!

good luck to myself for the coming exam at NOv (I think I will ......o_O!!).. dot dot.

jes@Tired.... ScriPt 17

I'M RED!!!!
My enemies are white and blue.
LOL..

Tired.. went to SIM today to submit my documents to them..
hopefully my application is successful.
Next.. how am i going to pay the sch fees...
Let me consider....Carefully consider...

jes@Millions of Sorry ScriPt 16

Hate MArch!! HAte March!! haTe mArcH!
itS a Bad Day...
Make me feel Like Crying..
feel bad..
have to said sorry to someone.. a busy woman, WK.
should'nt be so rude to her just now.. feel bad now lar..
think she should be really angry just now..
I should reflect myself ar.. -_-"
give me some courage... courage... courage..! where are mine??

ok... Now wanna to special thank
Prem.
for the..... long waited slip case for my laptop.... :)

jes@Yet To Give ScriPt 15

ok.. forgot to add in yesterday post..
1 more Present that I have yet to receive...
SLIP CASE for my laptop...
The person who own me this.. U know who u r hor.. Heee
Still Need to wait till 12 march to Get My SLIP CASE... .. cos it his pay day..
As Long as U give hor... I dun mind.. LOL

29th Feb.. have meet cilia for dinner at IMM - Ajisen...
and Mr prm come after we finish our dinner.
Well so long haven see her liao..she stilll Not bad.. Lol

then actually wanna to go JE library to drink coffee One..
But Hor.. when we reach there.. and thinking for what to rink for about 5 mins.. the Staff told us that It's Closed!.. zzz

Bo Bian we when to MAC to drink Iced lemon tea... LOL...
Then talk talk talk..

End f My stupid Post...zzz Haaaa

jes@TheLeapYear ScriPt 14

Today, 2008-02-29
Is THE LEAP YEAR or Should i say is THE LEAP DAY....

Knows More About THE LEAP YEAR

actually nthing special about this day... hahaa..
But it occur once evey 4 yrs...
so have to force something to my blog today.. Or next year I dun have the chance to blog at 02-29. LOL

Ok.. update on my birthday...
MY BELATED BIRTHDAY PRESENT..

==updated with===

A Perfume from my cousins...

a GUESS BELT which cost $70+..
will its a very X gift from my seconday school friend, lisa Ong.. ...
who I went in The Guess with her, thought that she wanna to get her $200++ GUESS bag, then Out of sudden she saw some belts.. and asked me which one nice, and asked me "U got wear belt one or not..?"... and then went to the casher and pay $$$.. the whole process is < 10mins....
zzzzz

A lunch treat from TL.. Miss AW..
or maybe no longer Miss oready.. HeeeLOL..
Shu fen was there also, so there is only 3 of us.... I was wondering Y she treat she treat shu fen also.. Cos.. i think is dun wanna to "Leng chang" later... .. is better to be 3 of us.. LOL

and lastly is a very de nice hp decorator from a colleague who sit beside me, miss Hai Yen...

Thank You Very Much!!...

jes@Happy 21st BirthDay ScriPt 13

Congratulation ~
Welcome to club 21,your approval has been approved by our 3 serior membersPrivilege:~
-> Watching R-21 movie
-> Voting in Jurong GRC
-> Doing thing w/p parental conscent
Once again, let us extend our warmest welcome to our new member...


Thanks to the 3 senior members:
The Chairman - Mr Poo YeowPing,
The CEO - rongni
The CFO sihui..


received my 1st gift from some colleague + a card..this is what wroten in the card...
A small Gift and a Happy BD to you will make someone feel touched..

==================================================================


23rd of Feb...


@ Cafe Catel
Our last day of 20th..

The 2 Bday gal, Miss Jessie Ho and Jesline Ho





The Delicious food..

The nice nice Birthday Cake..

The Meaningfull present.




Jesline: key of freedom..

Which i force my mummy to buy for me.... Hee...
She really brought it!


Jessie: Guess Wallet


The Beautiful Picture..





================================================================

24th of Feb

1st day of 21st...

What I did?
Went to crystal Jade for late lunch...

and then..
I went to IMM to buy what i want again...

and its cost a bomb!!

Press Here

jes@CNY ScriPt 12

Hoho...
Its time to Blog...
Happy Lunar New year!!
YEAR OF RAT!
going to talk about this few days...
How i spend my ChiNESE NEW YEAR

~~~~~~~~~~Chinese new year eve~~~~~~~~~~~

Half day work.zz went home sleep till SIx pm.
went to my Grandfather house at nite.
collected my 2nd Ang bao from my grandfather(1st ang Bao is from my father!).
But, this year no lucky draw leh...
Some years ago, my grandfather dun know get this lucky draw idea from where, he had 15 grandchildren, 6 of the Ang baos will have Addition Prize.
Two 1st prize, two 2nd prize, two 3rd prize.
what this means?
means that those who get the lucky Ang bao which stated 1,2 or 3 inside the Ang Bao will get extra $$ -_- ".
And the other 9 poor one will get the standard amount.
since then, every year during CNY my cute cute granbdfather will give out this 6 bonus to the 6 lucky one..
Althought the standard amount was also quite big lar, But I was very sad when i was not the lucky one who get the bonus every year... -_- ".
And this year no lucky draw zzzzz.

And the other Shocking thing is.. One of My uncle, came to us with a stack of $$$. Without RED PACKET one, and happily telling us that, this year no Red packet. Only $$, And it was a big $$. haha. This is one reason Y this year no lucky draw.

Then stay at my grandfather house with my sis and cousin and count down 5,4,3,2,1

HAPPY CHINESE NEW YEAR

went home @ 2+ AM,
helped to Book 12 movie tickets(CJ7) for first day of chinese new year.

~~~~~~~~~~End of Chinese new year eve~~~~~~~~~~~

~~~~~~~~~~First day of chinese new year~~~~~~~~~~~
Wake up @ 12+ PM
Prepare and went to my grandfather house again.


The 4 beautiful women



My happy Family


me and my cute jasmine sis and kiat cousin


My gang of cousin



Went to watch CJ7 with the gang of them.. What a disappointment movie! OMG!
What's next? after our movie... see below the picture!

Why are we standing there?



To see the Lion dance lor..


The lion dance


The lion dance2


well... mycousin was one of the lion dance crew

What's next after the Lion dance..

Steamboat lor! which i nv eat one.. cos of some reason lar.
then Gamble lor.
some played mahjong, some poker cards.. to find some ways to Entertain ourself.
and went home @ 2+AM again.
To Be continue.... ...
Stll have 2nd days Of CNY.. But I tired Now.
~~~~~~~~~~End First day of chinese new year~~~~~~~~~~~

jes@nthToDoMe ScriPt 11

is Script 11 Oready..

Not sure where the script 10 gone to, I wrote Script 10 in year 2008, 1st post in year 2008 yet it gone dont know where.. LOL

saw this link gaven by one of my IRAS colleague, there is one post about MRT("There is a reason that MRT train feels less frequent and more crowded..."), which i think is a FACT!

Take A look!

http://mrbrown.com/

for me... Yes So crowded when i leave from my workplace, taking train from novena MRT station.. to CITY HALL inter-change then to Lakeside Station..

How come I always have to squeeze into the packed train? And sometime, I have to wait for another packed train. And i paid soooooo Much to squeeze into the packed train...zz WTF.

Not only for Train, Bus TOOOOO.

Normally i dun take bus from lakeside station to my house (Except for raining days.. BO Bian, because is raining.) WHY?

I got 4 big reasons..

LONG WAITING TIME.

* How come the bus took so long to come ar.....

THE BUS IS CROWDED.

*There is so many pple no matter there is rain or no rain, there is sssoooooo many pple. I pay so much yet i cant get a sit and I have to squeeze with the rest... '_' "

IT IS DIRTY

*how come most the bus is so dirty. black black chair, funny funny smell, dirty dirty rubbish...

IT IS SO EXPENSIVE

*Why should i pay so much for all the above nonsense?

You can become more healthier tOo.

So Why should you take bus if u can walk home from MRT station wthin <20>waiting for the bus to arrive, waiting for everyone to squeeze into the bus with you, waiting for the bus to get going to the next stop, waiting for pple to squeeze through the bus and get down from the bus then the Blue colored Cycle start again(LOL). By the time u walked home, maybe the bus is still on its way to ur bus stop only leh... The difference is that you no need to pay, u no need to squeeze and you can be much healthier......

===== OK, End of My Post =====

jes@08_1stPost ScriPt 10

Wahaha my 1st Post @ 2008..

MR PREM.. I post something oready.. U saw It, U saw It, U saw It??? LOL

MR PREM, so When Are U going to Give me My Blog Skin!!..

half a Month had gone. so fast!

jes@lastDayOf2007 ScriPt 9

Yoyo, so long seem my last post..
Last day of 2007..
And this is my last post of 2007.
Suddenly felt so lonely. lol
Lucky got Eng Suo who drink Vodka(Pear), eat chocolate, eat peanut, watch TV with me..hahha.
It is a bad year 2007.
it is also a not bad year 2007, at least the first half of the year is a good year.
2008 is coming in a few hours time. There is only now and MY future.
New year, New Year. awaiting for the new Year.
And i have a big plan in year 2008. Hope the plan will come true.. Hope HOPE hope...
It is a special year for me...
because
"A Key of freedom" is waiting for me... ... ...
See You Next Year.
Good nite.. zzzzZZZ

jes@spentThe$$Day ScriPt 8

Wahahahahhah..
So happy today.

I get what i want, i get everything I want.

Today is THE SPENT all MY MONEY DAY.
went to buy 2 pants at Jp just now. cost $50~
then went to meet Prem and brought WHAT we want @ raffles city!

what we want!

this is mine .. and it cost a bomb!

This is what we eat.. Thai Express....

This is what we drink!.. starBucks..

"Santa Claus drop the money for me to spent".. LOL

"we are not Rich ass..."

really enjoy my day today.

jes@sianDiao ScriPt 7

just came back FRom AMK Hub(i hate AMK) LOL
just eaten 2 donuts from donut factory my supper!

Went to meet Jo and sc and prem also at AMK!.
hmmm... strange strange feeling...

Let the past be the past. It is over. There is nothing you can do about it. It doesn’t matter what you do now you cannot change the past. The past has got you to where you are today now, move on.
There is only now and MY future.
So, instead of focussing on the past, focus on doing your best; now.
If you feel really fed up. If you feel as though the world is against you. If you feel as if you should have done better.
There is only one thing you can do.
SMILE.
"Here, on this earth because the world needs you as you are! You are important to the world, just as you are. You have an important role to play. Just look at yourself. You can only be yourself... there is no possibility that you can be anybody else. You are unique. you are full of possibilities"

so just enjoy your lifevand bloom,
don't wither away like a dead flower.
Go on…… accept it!

let's start a NEW year! looking forward to year 2009.
opppss,
is 1.40am now..
but no worry..
cos tomorrow is public holiday! HAPPY publiC Holiday!

jes@office ScriPt 6

Lunch hr time..
I was waiting for Mr. Prem to have lunch with me...
Hungry Hungry!..
Mr Prem finally Called me... Lunch 1st.

jes@1stTear ScriPt 5

DO u remember this:




DNA -> Transcription -> RNA -> Translation -> PROTEIN
GATCTAGTGCTAGTCGATCGTAGCTAGCTAGCTAGTTTTCGATCG
5' → 3' , 3' → 5'
Needleman-wunsch
BLAST
DOT PLOT
and ALOT ALOT BIO THIS AND BIO THAT
LOL

so When is my FIRST tear in school(PRI, SEC,POLY)?
when i feel so stress with that MASCOT FILTERING TOOL, that WTH C#.net, and that WTF F**ker, feel so lonely inside the BIOMEDICAL ENGINEERING HUB, so shag....
THE BEST Thing!
Being PS by 2 friends for lunch, when i only have them to have lunch with, when i have told them I WAS ALONE and ASK them to PEI me EAT a few hours back only! within that 10seconds, being ps by them. This is when I dropped my 1st TEAR in school, NYP. During my most SHAG time, most STRESS time, and MOST SAD TIME. I gonna PS WITHIN that 10s. I WILL NV FORGET!

Ya, People become stronger because they have thing they cannot forget!

and therefore

I BECOME STRONGER!

jes@omg ScriPt 4

what's Happening today?
My 1st report at BoonLay NPP! but is not regarding myself zzz.. Just helping to translate..

Went to my Grandpa house today. Saw my grandpa, he is getting older each time i visit him. HAVE YOU EVER ASK YOURSELF, WHEN IS THE LAST VISIT YOU VISIT YOUR GRANDPARENT?

The happening is below
======================================
Eng suo: shan, let's go le.
Jeszzho: go where?
Eng suo: Boon lay..
Jeszzho: go there for what?
Eng suo: uncle wanna to get police report for divorce thingy.. we go tag along.
......at Bonnlay NPP.....
when we reach there.. what i saw? A MALAY POLICE OFFICER! oh gosh.....
======================================

That's how i become a temp translator..

jes@happy ScriPt 3

Yoz,

someone say my blog very de EMO..
OK, today not going to be emo..

I going to teach you how to play with Rubik's cube. which i have just learnt also..
VERY SImPLE, pRovided that you aRe as clEver as me la....
noted that Rubik's Cube is to be solved LAyer by layEr!! very impt.



This is my cube... Play till lan oready.



Step 1: have to make the cross 1st. any color cross. In this case i chosen white.



Step 2: Solve the 4 white corner. The first layer got to solve by yourself... very simple de... goT to understand! U can see.. the 1st layer of orange and the green is in place also... pls go figure out Y they must be in place like that -_- '".



Step 3: 2nd layer... have algorithms to solve the 2nd layer. u can prefer to: http://www.youtube.com/watch?v=HsQIoPyfQzM / http://www.youtube.com/watch?v=IW_BBp3FPMQ&feature=relatedmust understand also. LOL i cheated..



Step 4 : the last layer! A cross 1st also.. refer to : http://www.youtube.com/watch?v=IW_BBp3FPMQ&feature=related / http://www.youtube.com/watch?v=HsQIoPyfQzM also..


COMPLETED!

Very simple right?

jes@eMo ScriPt 2

Just came back from somewhere... Still felt very SHAG

but when i reach home...:
=================================================
Eng Suo: Got give her the $$ or not?
Jeszzho: WHAT MONEY? WHAT MONEY?
Jasbaobei: Got $300 lor..
Jeszzho: WHAT $300?
Jasbaobei: xxX give us $50 lar..

My heart: WAW.. the god so good, know i no $$ leh, drop $$ for me to spend $_$. hehee
My Heart: wa lao.. why the one who tio 4D not me......
=================================================

well..
This let me felt that this sentence is MOST right.
The rich become richer and the poor is still the poor..

see ar,
The rich, they have more money to buy 4D. They can bet a alots of 4D with a lots of $$. They can bet as big as they want, and then when they win, they win alots, alots and alots. And they in the end become RICHER.

The poor, who will not buy so big and so much as they are the poor, and then when they win, they are still the POOR.

ok. Still felt very shag today. Because.. it seens that things is getting bad to worst.